Skip to content

9

Duana Fullwiley is a medical anthropologist who graduated in 2002 from UC Berkeley and UC San Francisco with her Ph.D. Fullwiley has conducted a multi-sited field research in the United States about the emergent technologies that measure human genetic diversity among populations and between individuals. Her main interest is how scientists promote genetic citizenship. This was Dr. Fullwiley’s second book project and explains exactly how U.S. political concepts of diversity, usually glossed as “race,” function in genetic recruitment protocols and study designs for research on complex diseases, “tailored medicine,” ancestry tracing, and personal genomics.

Dr. Fullwiley’s first book is The Encultured Gene: Sickle Cell Health Politics and Biologicalss Difference in West Africa. This book was written in 2011, and received the 2014 Robert B. Textor and Family Prize for Excellence in Anticipatory Anthropology from the American Anthropological Association, and the 2011 Amaury Talbot Prize for African Anthropology from the Royal Anthropological Institute. This book used data gathered from ethnographic fieldwork in Senegal, France, and the United States. She uses her fieldwork data and weaves together postcolonial genetic science, the effects of structural adjustment on health resources, and patient activism between Senegal and France to show how African sickle cell has been ordered in ethnic-national terms at the level of the gene.

She used to be a professor at Harvard and is now an associate professor at Stanford University teaching courses in medical anthropology and anthropology of science. She is currently in the research stages for her second book Tabula Raza: Mapping Race and Human Diversity in American Genome Science.

https://web.stanford.edu/dept/anthropology/cgi-bin/web/?q=node/1079

http://press.princeton.edu/titles/9613.html

The world as a global structure is composed of an “admixture” of genes. This “admixture” is a population whose genes consist of different inherited blood lines (i.e. European, African, Asian, and Latino).  Among these different descendants, race becomes an issue. Race is viewed throughout the Fullwiley, and Weiss and Long article as a way in distinguishing health disparities, a way of explaining Darwinism, and a crucial statistical relation to biology. Within this particular framework, population genetics and ancestral lineage plays a role in human settlement and development of the human body. This brings me to my article entitles, “The Case against Biological Realism about Race: From Darwin to the Post-Genomic Era.” In this piece, Maglo argues that race functions in contemporary human population genetics, more like a convenient instrumental concept than biological category for picking out sub specific evolutionary kinds.

Evolution is a term coined by Charles Darwin. It is described as the development of different types of organisms by natural selection. In Darwin’s description race was presented in his theory of application; however Maglo describes how race through the idea of “progression” among a species has created a framework of racial hierarchy that is inevitable in the biogenetics world. He explains how science as accumulated findings among minority groups, specifically African Americans has been the blue print to disease. A group of researchers argues that race has an objective biological reality, and is a valid prediction tool of genetic and phenotypic variation within our species, while another group counters that race is biologically meaningless and a weak predictive factor of human genetic and phenotypic variation. Which group of researchers would you agree with? I would personally argue the second group. Race is a social construct. IT was created as a subsection by Herbert Spencer with Social Darwinism in the 19th century. Social Darwinism states that Darwin’s idea is valid, but only through social progress. Well, we don’t need to embark upon the history of what “group” could socially progress, I’m sure the answer is pretty straight forward. With that being said, progression among the human species is a science created through race.

The biological make-up of the human body regardless of skin color, works as a system designed for survival. The genes that a human body is composed of may be different, but their functions unless otherwise defective, all contribute to homeostasis. Without, the critiques of previous evolutionists/scientists (Spencer, etc.) biology would simply only contain a genus/species relation, not a subspecies among human organisms. Even the idea of polygenesis is a key principle of evolution among present day scientists/biologists. Why? Humans are humans, Apes are Apes, and microorganisms are microorganisms. Polygenesis relates to the idea that some humans (i.e. minority groups-African Americans) are a subgroup of individuals that share common characteristics. Who came up with this? The issue is one of high concern among researchers today. These concepts began to group certain people in an array of abnormalities that doesn’t necessarily apply on a biological level. Now, race is clearly a visual aspect that has been created to systematically categorize development, substanciabilty, and tactical relations of disease. Is it right, no; however, is there a solution to the erasing RACE completely in regards to biology? Is this possible?

Maglo, Koffi N. Perspectives on Science 2011, vol.19, no.4. 2011. "The Case against Biological Realism about Race: From Darwin to the Post-Genomic Era

5

Epigenetics is the study of the processes that underlie developmental plasticity and canalization and that bring about persistent developmental effects in both prokaryotes and eukaryotes. In my research, I came across a rather difficult yet slight interesting article entitled, “How might epigenetics contribute to ecological speciation?” Ecological speciation involves the formation of a new species in the course of evolution with one’s physical surrounding. It interplays with adaption to different environments and the concurrent incompatibility of reproductive isolation. Epigenetics is viewed as a process that does not interrupt the DNA in organisms. It can be an induced processed based from generation to generation through germ line cells or somatic cells. However, in embryonic development epigenetics changes its course. In the formation of a zygote, DNA methylation can occur as a biochemical process. Most epigenetics witnessed in this article pertain to DNA methylation and phenotypic plasticity. Of course, phenotypic plasticity is in more correlation to fish or the Drosophila in this research more so than humans. In this piece, Smith and Ritchie describe phenotypic plasticity as often allowing organisms to respond adaptively to environmental factors. Adaptation to a range of new environments may follow a single invasion event, for example when fish invade glacial or other new lakes, or occur with on-going gene flow or fluctuating environments.

One interesting and understandable method mentioned in this article was the criticisms of epigenetic marks in evolution. There we three main factors that contribute to the controversy. First, epigenetic variation is not seen as a primary driver of evolution in the same way as mutations. I personally cannot disagree or agree with this critique, because a mutation is usually witnessed with a disruption of DNA in humans, not necessarily the external environment; however, I cannot speak for all other organisms. Secondly, an important aspect of Neo-Darwinism is that evolution is not “directed”, since it can be induced and stably inherited, it can then be seen as directed. Thirdly, epigenetic marks are seen as dependent on DNA and thus do not evolve independently of genetic variations. Now, this I can partially agree. I realize in this article as well as the required reading by Jalon and Razz that RNA was mentioned throughout in regards to prions, rRNA, and DNA methylation. I couldn’t see how RNA could be discussed without the use of DNA since they are partners in regards to translation and transcription. Later however, I did realize epigenetics transformation from generation to generation with induction and allopolyploidization. In all, one’s environment can result in adaptability among organisms without altering their DNA obviously. Now, do I agree completely is a different question.

1

Cite: Turkish Journal of Medical Sciences (12/1/2013) http://eds.a.ebscohost.com/eds/pdfviewer/pdfviewer?sid=99d3b622-6d0f-49f9-89ab-c502cd16a588%40sessionmgr4003&vid=2&hid=4203

This week’s reading is based upon allele frequency among certain populations. While reading this chapter, I came across a very interesting article evaluating allele frequency in Europe in relation to Africa, Asia, and South America. In this article is speaks on the mutant CCR5 delta 32 allele. This allele has been researched, and data shows resistance to HIV and later developed AIDS. As we all know, there is not a cure for AIDS; however; I personally didn’t know there was even a resistance to the disease besides condoms and abstinence. I mean please correct me if I’m wrong. This is exactly why this article intrigued me greatly. In this experiment, 400 healthy individuals were chosen and blood samples of 2cm^3 were taken to see if the allele was present in each individual. With this experiment, the participants were mostly not of African descent. It has been statsically proven that people of African American descent are more infected with the deadly disease, and therefore positioned as an “African American” disease. Now, I do not agree with this categorically since the spread of the virus/disease has been historical recorded to have originated from a South African (White) male. So, how exactly is it considered to be a “Black” disease? Either way, this ideological approach is also the reason why I believe more research should be done in this area concerning individuals of African descent solely. I’m sure the authors of this article would highly disagree seeing as if the allele frequency was so low that Africa or groups of African blood were not really considered. On a different note, the allele is said to be detected from chemokine receptors located on the third chromosome. This then interacts with the chemokine 2 receptor with the 32 base pair amino acid deletion sequence of one’s gene. This mutant gene is then related to HIV resistance. The results are as follow:

Results

CCR5-Δ32 allele frequency as related to resistance against

HIV was determined with the analysis of blood samples

Obtained from a total of 400 individuals. Blood samples

Were collected in such a way as to represent all provinces

included in the region. Twenty-one of the individuals

who were screened with 2 primers were found to be

heterozygous in terms of the CCR5-Δ32 allele (CCR5/

CCR5-Δ32). No homozygous individuals (CCR5-Δ32/

CCR5-Δ32) were determined in the study. A single band

measuring 241 bp was detected in individuals with the

CCR5/CCR5 genotype and 2 bands measuring 209 and

241 bp were determined in individuals with the CCR5/

CCR5-Δ32 genotype as a result of screening samples with

the SP4.760 primer (Figure 1). A single band measuring

225 bp was detected in individuals with the CCR5/CCR5

genotype and 2 bands measuring 193 and 225 bp were

determined in individuals with the CCR5/CCR5-A32

genotype as a result of screening with the AB primer

(Figure 2).

While the wild allele frequency was found to be 0.9738

for all individuals, the mutant allele frequency was 0.0262.

In the statistical analysis done according to geographical

regions, while wild allele frequency was found to be 0.9590

for the population representing the Black Sea region,

Table 1. Distribution of participants according to number and

regions.

Regions Number of participants

Black Sea region 61

Marmara region 58

Aegean region 57

Mediterranean region 54

Southeast Anatolia region 54

East Anatolia region 54

Central Anatolia region 62

TOTAL 400

Table 2. Names and sequences of primers used in the study.

Names of primers Sequences of primers (5’-3’)

SP4.760 CCTCATTACACCTGCAGCTCT

CACAGCCCTGTGCTTCTTCTT

AB ACCAGATCTCAAAAAGAAGGTCT

CATGATGGTGAAGATAAG CCTCACA888

KARAKAYA et al. / Turk J Med Sci

mutant allele frequency was 0.0410. No heterozygous

individuals who had the mutant genotype were detected

in the population representing the Marmara region.

While wild allele frequency was found to be 0.9825 for

the population representing the Aegean region, mutant

allele frequency was 0.0175. While wild allele frequency

was found to be 0.9274 for the population representing

the Central Anatolia region, mutant allele frequency was

0.0726. While wild allele frequency was found to be 0.9722

for the East Anatolia region, mutant allele frequency

was 0.0278. While wild allele frequency was found to be

0.9907 for the population representing the Mediterranean

region, mutant allele frequency was 0.0093. While wild

allele frequency was found to be 0.9907 for the Southeast

Anatolia region, mutant allele frequency was 0.0093. The

Central Anatolia region was found to have the population

with the highest heterozygous percentage among the

analyzed populations. Heterozygous statistical values

for all individuals are given in Table 3. In addition, the

chi-square value used in Hardy–Weinberg equilibrium

analysis was estimated to be 0.276506, the freedom degree

to be 1, and probability (P) to be 0.599000 (Table 4).

7

Rebecca L. Cann is a geneticist who, along with her colleagues, is best known for the Mitochondrial Eve hypothesis (1987). Mitochondrial Eve explains that our human mitochondrial DNA can be linked back to a single African mother from over 200,000 years ago. The Mitochondrial Eve is the ancestor of us all. Since the publication of her paper in 1987, Cann's finding have had a huge impact on human society by contributing evidence for the "(Recent) Out-of-Africa" model.

Rebecca Cann was originally born in Burlington, Iowa. She moved to San Francisco right before starting high school. After graduation, she earned her bachelor's (1972) at the University of California, Berkeley. In the gap between earning her Bachelor's in Genetics and enrolling for graduate school in the Anthropology Department (1972-1974), Cann's interests in human variability and personalized genomes ignited while working as a night-time quality control chemist. Her job exposed her to a lot of scientific journals and articles that made her very inquisitive in how human genotypic variation creates such different phenotypes. Upon learning about restriction enzymes in 1974, Cann decided to enter graduate school to work in molecular anthropology and human evolution. She earned her doctorate in 1982 under the supervision of Dr. Allan Wilson. She worked her Postdoctoral at Howard Hughes Medical Institute until joining the faculty of Univerity of Hawaii's Department of Cell and Molecular Biology in 1986. The following year Cann's "Mitochondrial DNA and human evolution" paper was published Nature (1987).

Currently Cann is a professor at the University of Hawaii.

Will today it may seem extremely basic knowledge, Mendelian genetics was a complete revolution at the time it was shown the spotlight. Just like Darwin, Mendel's work was advanced for its time, and it took a great deal of time for their ideas to get tractions. However, Mendel was able to discover something that Darwin had struggled his entire life to understand: a mode of inheritance. Before modern microscopes, Mendel was able to comprehend a process that is invisible to the human on based on rigorous and patient methods of observation. He time as a monk was important to the tedious but important work he contributed to science.

diagram of genotypes of pea plants in 3 generations after cross-pollination

Mendel observed the very basic elements of inheritance through the pea plant. Simple dominent or recessive genes were observed through the physical color and shape of the pea as well as the size of the plant. Observations throughout countless generations allowed for Mendel to draw conclusions on the mode of genetic inheritance.

Just like Darwin, Mendel lived a simple life, which allowed him to devout an immense amount of his time to research. He spend 8 tedious years studying how each pea plant came to have the physical characteristics that they did. While the Punnett Square was not a product of Mendel, it is often associated with his legacy because it is the easiest way to demonstrate his genetic theories.

http://www.nature.com/scitable/topicpage/gregor-mendel-and-the-principles-of-inheritance-593

http://anthro.palomar.edu/mendel/mendel_1.htm

6

Gregor Mendel

Johann Mendel was born to Anton Mendel and Rosine Mendel in what used to be Heinzendorf, Austria on July 22, 1822. His father was a farmer, so Mendel would help out with the chores around the farm. His family was not poor, but sending Mendel to school in Troppau at the age of 11 created strain on their finances. In 1840, he graduated from regular school. After his graduation from secondary school, he entered the Philosophical Institute of the University of Olmütz for two years. To make ends meet he would tutor other students. During this time he often had problems with depression, which resulted in him stopping studies at times. With his problem with depression Mendel was able overcome it and graduate in 1843.

This time of financial struggle is what influenced Mendel to enter the monastery of the Augustinians of Bruenn in 1843. He joined the monastery against his father’s wishes; he wanted him to take over the farm. This is where he received the name of Gregor. The monastery helped give Mendel access to a large library and experiment facilitates, as well as the research of his fellow members. In 1849, Mendel had worked himself to the point of being ill and was sent to teach in Znaim. In 1950, he failed a test to continue teaching and as a result was sent to continue his studies of science in 1851 at the University of Vienna, this was paid for by the monastery. While at the university, Mendel was able to study math and physics under Christian Doppler and botany under Franz Unger, which would later influence his work with pea plants. He graduated in 1853, and shortly after, was given a teaching post at a secondary school that he would keep for over a decade. The time that he was working as a teacher is when he was conducted his pea plant experiments from 1856 to 1863. In 1865, he gave two lectures on his findings from his pea plant experiments, though nothing resulted from them at the time. It is believed that Mendel was not confident in his work and that it he was just presenting already known information. In 1868, Mendel was hindered from doing scientific experiments by his failing eyesight and being elected abbot of the school he had been teaching at for over a decade.

            Mendel died in January 6, 1884. Unfortunately, Mendel did not get much credit for his work till after his death. In the 1900’s, scientists began to look at Mendel’s research and realize that is was not the usual genetic information that was being experimented on and published at the time.

Iltis, H. (1943). Gregor Mendel and his work. The Scientific Monthly, 56: 414-423.

Gregor Johann Mendel. (2014). The Biography.com website. Found at:      http://www.biography.com/people/gregor-mendel-39282.

Photo from: http://en.wikipedia.org/wiki/Gregor_Mendel

During this week's reading, I came across an article by Eric Lassiter entitled, "Invitation to Anthropology. It is an article that uses genes, chromosomes, and evolutionary biology in a different manner, but simutaneously the same. In this anthropological piece, Lassiter retraces the idea of biology among the Black female body. He chooses to investigate non-other than Sarah Bartmann, also known as "The Venus Hottentot."This African non-slave woman was taken under great scrutiny by two European scientists in the later 19th century. These scientists dissected every inch of Bartmann's body starting with her cranium on to the bottom of her feet. The brain of a Black woman was sized categorically as one of difference in regards to Europeans. They viewed her as an animal species, not one of homo sapiens. In doing so, the part of the body that intrigued them the most was her very over enlarged buttocks. A buttocks, that had never been seen on any other Black female body of that size. These scientists began to conclude that Bartmann's brain, buttocks, and breast were strictly related to the gorilla species, in which her enlarged buttocks supposedly relates. The inferiority complex was based on the mere idea and research that her genetic make-up was one disrupted through mutation. Mutation was considered during this time period as any phenotypical appearance different from that of the White European female. This "mutation" was set on display in a over sea's circus with other "freaks" such as the world's fattest man, the tallest woman, etc. These mutations were said to have a genetic make-up relating to animals only. The two scientists concluded that Bartmann was indeed not a woman based on the biological research found. She was considered to have some "human-like qualities" but no humane. These findings have created a ideological construction of racial difference embedded in biological practices. I am aware today that technology has surpassed such ludacris mentality, but have they really? I ask this question to not only take into the account of one's DNA, but to also have one explain the genetic makeup of a human whose genes coded for an allele for an over sized buttocks or enlarged breasts but isn't present among the parents.  DNA is genetic material inherited from both parents right? So, what happens when neither parent has an allele for a large buttocks, maybe this trait isn't even witnessed in any generations of this person's human genome. Then to what extent is this phenotypical expression explained...I bet those two European scientists would agree to mutation/polymorphism. What would you say?

Lassiter, Luke Eric. Invitation to Anthropology. United Kingdom: Alta Mira Press, 2009.   3-14.

"Raymond Pearl." Via Wikipedia - http://en.wikipedia.org/wiki/File:Raymond_Pearl_o.jpg#mediaviewer/File:Raymond_Pearl_o.jpg
"Raymond Pearl." Via Wikipedia - http://en.wikipedia.org/wiki/File: Raymond_Pearl _o.jpg#mediaviewer/ File:Raymond_Pearl_o.jpg

Raymond Pearl, Professor of Biology in the Medical School and in the School of Hygiene and Public Health of the Johns Hopkins University, died at Hershey, Pennsylvania, November 17, 1940, at the age of sixty-one years. At the age of 16 he entered Dartmouth College, expecting to make the classics his chief field of study. During his first year he was more interested in the opportunities for free activity than in his studies; a fact which was reflected in the low grades which he received. But in that first year biology was a required subject, and this opened his eyes to what became his main interest. He graduated from Dartmouth with the degree of A.B. in 1899. According to the Class Report before cited "Pearl was the youngest graduate in our class." During his senior year he was assistant in the course in general biology, of which the present writer was at that time in charge. He showed at that early period the masterful and competent personality that marked him throughout life.

In the fall of 1899, Pearl went to the University of Michigan, while for three years he was an assistant in Zoology while at work as a graduate student. He took part in the Biological Survey of Great Lakes, founded and led by the late Jacob Reighard working on variation in fishes (1900- 1902). He received in 1902 from the University of Michigan the degree of Doctor of Philosophy, at the age of twenty-three. From 1902-1906 he was a professor of Zoology at the University of Michigan. It was in the laboratory of the University of Michigan where he met Maud. M. De Witt, who became his wife. They were married in 1903, and upon his death bed she became managing editor of the journal “Human Biology”, and assistant editor of the ‘Quarterly Review of Biology”- the two journals founded and edited by Pearl. In the year of 1905-1906, Pearl he decided to enter the field of the application of statistical method of Biological problems with Karl Pearson at the University College, London. During the same visit to Europe he worked also at Leipzig and at the Marine Biological Station at Naples. Pearl returned to America in 1906, and was an instructor in Zoology at the University of Pennsylvania in 1906-1907. In 1907, he went to the University of Maine in Orono, as head of the department of Biology of the Maine Agriculture Experiment Station, remaining there until 1918. In 1918, Pearl was called at instance of Dr. William Welch, to become professor of Biometry and Vital Statistics in the newly found School of Hygiene and Public Health of John Hopkins University, where he spent the remainder of his educational career and training.

Before Pearl received his doctorate, he published a number of contributions. His dissertation was on the actions and behavior of Planarians. He next contributed a series of papers on genetic problems in lower organisms in which he worked with Karl Pearson in London. Also while in London, he finished and elaborated statistically a valuable piece of work on assortative mating in Protozoa. While at John Hopkins University, his interest in many subjects was so intense that at any given moment he might seem a partisan and propagandist of a particular method of biological science. Among the seven hundred and twelve titles (including seventeen books) in the list of Pearl’s writing hereto appended will be found contributions on the most varied fields of aspects biology or as human affairs as a division of biology. There are papers on animal behaviors, to Protozoa to man; on general physiology; many of various aspects of genetics (on abnormalities, variations on the breeding of Drosophila, of poultry, of cattle, of corn, of cantaloupes, on tongue colors in cattle, on the color hen’s eyes, etc.) There are many technical contributions on the care and breeding and fowls (fertility and diseases of fowls, plumage patterns, egg production, keep fowls free from lice, and folk-lore of hens’ eggs). Furthermore, many papers deal with the biology of man: papers on longevity and mortality, on the effects of alcohol and tobacco, on eugenics, and race culture, on the biology of superiority, the biology of death, infant mortality, and contraception.

8

Reading the chapter for this week about the history of human biology left me wondering what new information has come out since the publication of this chapter/book. Upon my search, I found an article in American Anthropologists discussing some of the major research that was published in 2012 that has helped to start shifting some long held theories. James Sun and colleagues did one of the main pieces of research discussed in this article. Sun’s research, along with others, has found that the “baseline rate of mutation, directly estimated from genomic sequencing, is slower than previously suspected (263, Van Arsdale).” This finding may influence the previous rate that evolution took place and more research has to be done before any large changes are made in the past research findings. The research I found the most interesting was that done by Herman Pontzer on the energy expenditure of hunter-gatherers. He studied thirty Hadza adults from Tanzani who are hunter-gathers, to compare to industrial populations. Ponzer found that the amount of energy expended by the Hadza was not significantly more than someone from the United States. This study helps to highlight the influence that energy consumption has on the cause obesity and how obesity is not all reliant on the lack of energy expenditure and lifestyle. The article also included a bit about open access journals and blogging one’s articles before it is published. I thought this part was an intriguing because it has some sort of reference to our class with the blogging we are doing. The publishers of journals do not like the blogging because it makes the articles irrelevant by the time they are finally published. I think this brings up a key question of what is more important making money off of these findings or sharing the information with people so that everyone can be better educated?

Overall, the article was insightful in showing how quickly research can come along that changes our ideas about a subject. The article featured the changing atmosphere of the academic world with the use of technology, which was really the first time I have seen how technology might change the way that influential journals, such as Human Biology, influence the research done as it has in the past.

2013. A shifting theoretical framework for biological anthropology in 2012. American Anthropologists, 115, 262-272.