Skip to content

The human body is very complex, yet simple mechanism. The way in which cholesterol (fats), minerals, and vitamins contribute to the nutrients within the body range. The human body is made of millions of cells that are directed by DNA to make certain proteins, which then code for the insertion of amino acids (polypeptide chains). These amino acids then contribute to enzyme regulation and the production of hormones throughout the body. All of these components contribute to cell nutrients, the amino acids that our bodies are not capable of making must be consumed through foods. When the body does not consume the right amount of amino acid or vitamin supplement, it begins to become insufficient and incapable of ridding the body of toxic materials, as well producing a healthy immune system. In all, the way you eat, the amount of water consumed, and your ability to help the body rid unhealthy fats (toxins) by exercising and detoxification are the mechanisms for having a productive body.

Most Americans in the United States are considered to be obese. The body is made up of fat cells from the accumulation of cholesterol. Keep in mind, all fat isn’t bad fat. Yes, there are healthy fatty acids inside the body that contribute to the body’s overall energy consumption; hence; why one is able to exercise or simply keep the body in motion. Fatty acid cells are found in the muscles of cells and produced by lipoproteins. They are also referred to as adipose tissue. The accumulation of too many fatty acids cells contribute to obesity. Obesity is a condition that is considered to accompany an unhealthy lifestyle. It also slows the body’s circulation because not enough oxygen can pass through selectively permeable membranes. This in turn leads to blood clotting and obviously an accumulation of fatty tissue all over the body. Most people who are obese are consumers that cannot control their calorie intake. Calorie intake is the issue at hand in order to help produce a healthy lifestyle.

In the article I found entitled, “Calcium and Vitamin D for Obesity” researchers used a review of randomized control trials (RCT’S) to show if more calcium and vitamin D intake help contribute to weight loss. They used the trial with women only. Among these women, there hypothesis consisted of the idea that calcium intake during weight loss should result in greater fat loss. The fat percentage measured on the body is the total accumulation of fat in the body. The higher the percentage the higher the risk of heart disease. Also, weight loss was only considered in this trial in relation to BMI and fat percentage. Researchers were not simply intrigued by the number on the scale. They found that calcium and vitamin D support does not support calorie intake, but can suppress appetite. Researchers also reported higher calcium was much better than moderate calcium accelerating weight loss over time; though, differences in fat mass were not significant. On the other hand, vitamin D supplementation presented no effect on changes in body weight, waist-hip ratio, or percent fat mass. Overall, the idea that calcium and vitamin D contribute to weight loss was highly insignificant. I do believe the study may have been done broader and more biological aspects should have been taken into consideration. The study was only used with women, but the calcium or vitamin D present prior was not taken into consideration. These trials could have very well been witnessed on calcium deficient individuals, which then places the trial under high scrutiny. In other words, maybe this randomized trial should have been a conditioned group of women to measure such bodily contributions. Do you agree?

Delfos, Chan, Ghanbari M. Calcium and Vitamin D for Obesity: A Review of Randomized Trials. European Journal of Clinical Nutrition. Sept. 2011, Vol. 65. Issue 9 p. 994-1004.

(Ch.7 Blog entry- Human Nutrition)

1

Cite: Turkish Journal of Medical Sciences (12/1/2013) http://eds.a.ebscohost.com/eds/pdfviewer/pdfviewer?sid=99d3b622-6d0f-49f9-89ab-c502cd16a588%40sessionmgr4003&vid=2&hid=4203

This week’s reading is based upon allele frequency among certain populations. While reading this chapter, I came across a very interesting article evaluating allele frequency in Europe in relation to Africa, Asia, and South America. In this article is speaks on the mutant CCR5 delta 32 allele. This allele has been researched, and data shows resistance to HIV and later developed AIDS. As we all know, there is not a cure for AIDS; however; I personally didn’t know there was even a resistance to the disease besides condoms and abstinence. I mean please correct me if I’m wrong. This is exactly why this article intrigued me greatly. In this experiment, 400 healthy individuals were chosen and blood samples of 2cm^3 were taken to see if the allele was present in each individual. With this experiment, the participants were mostly not of African descent. It has been statsically proven that people of African American descent are more infected with the deadly disease, and therefore positioned as an “African American” disease. Now, I do not agree with this categorically since the spread of the virus/disease has been historical recorded to have originated from a South African (White) male. So, how exactly is it considered to be a “Black” disease? Either way, this ideological approach is also the reason why I believe more research should be done in this area concerning individuals of African descent solely. I’m sure the authors of this article would highly disagree seeing as if the allele frequency was so low that Africa or groups of African blood were not really considered. On a different note, the allele is said to be detected from chemokine receptors located on the third chromosome. This then interacts with the chemokine 2 receptor with the 32 base pair amino acid deletion sequence of one’s gene. This mutant gene is then related to HIV resistance. The results are as follow:

Results

CCR5-Δ32 allele frequency as related to resistance against

HIV was determined with the analysis of blood samples

Obtained from a total of 400 individuals. Blood samples

Were collected in such a way as to represent all provinces

included in the region. Twenty-one of the individuals

who were screened with 2 primers were found to be

heterozygous in terms of the CCR5-Δ32 allele (CCR5/

CCR5-Δ32). No homozygous individuals (CCR5-Δ32/

CCR5-Δ32) were determined in the study. A single band

measuring 241 bp was detected in individuals with the

CCR5/CCR5 genotype and 2 bands measuring 209 and

241 bp were determined in individuals with the CCR5/

CCR5-Δ32 genotype as a result of screening samples with

the SP4.760 primer (Figure 1). A single band measuring

225 bp was detected in individuals with the CCR5/CCR5

genotype and 2 bands measuring 193 and 225 bp were

determined in individuals with the CCR5/CCR5-A32

genotype as a result of screening with the AB primer

(Figure 2).

While the wild allele frequency was found to be 0.9738

for all individuals, the mutant allele frequency was 0.0262.

In the statistical analysis done according to geographical

regions, while wild allele frequency was found to be 0.9590

for the population representing the Black Sea region,

Table 1. Distribution of participants according to number and

regions.

Regions Number of participants

Black Sea region 61

Marmara region 58

Aegean region 57

Mediterranean region 54

Southeast Anatolia region 54

East Anatolia region 54

Central Anatolia region 62

TOTAL 400

Table 2. Names and sequences of primers used in the study.

Names of primers Sequences of primers (5’-3’)

SP4.760 CCTCATTACACCTGCAGCTCT

CACAGCCCTGTGCTTCTTCTT

AB ACCAGATCTCAAAAAGAAGGTCT

CATGATGGTGAAGATAAG CCTCACA888

KARAKAYA et al. / Turk J Med Sci

mutant allele frequency was 0.0410. No heterozygous

individuals who had the mutant genotype were detected

in the population representing the Marmara region.

While wild allele frequency was found to be 0.9825 for

the population representing the Aegean region, mutant

allele frequency was 0.0175. While wild allele frequency

was found to be 0.9274 for the population representing

the Central Anatolia region, mutant allele frequency was

0.0726. While wild allele frequency was found to be 0.9722

for the East Anatolia region, mutant allele frequency

was 0.0278. While wild allele frequency was found to be

0.9907 for the population representing the Mediterranean

region, mutant allele frequency was 0.0093. While wild

allele frequency was found to be 0.9907 for the Southeast

Anatolia region, mutant allele frequency was 0.0093. The

Central Anatolia region was found to have the population

with the highest heterozygous percentage among the

analyzed populations. Heterozygous statistical values

for all individuals are given in Table 3. In addition, the

chi-square value used in Hardy–Weinberg equilibrium

analysis was estimated to be 0.276506, the freedom degree

to be 1, and probability (P) to be 0.599000 (Table 4).

During this week's reading, I came across an article by Eric Lassiter entitled, "Invitation to Anthropology. It is an article that uses genes, chromosomes, and evolutionary biology in a different manner, but simutaneously the same. In this anthropological piece, Lassiter retraces the idea of biology among the Black female body. He chooses to investigate non-other than Sarah Bartmann, also known as "The Venus Hottentot."This African non-slave woman was taken under great scrutiny by two European scientists in the later 19th century. These scientists dissected every inch of Bartmann's body starting with her cranium on to the bottom of her feet. The brain of a Black woman was sized categorically as one of difference in regards to Europeans. They viewed her as an animal species, not one of homo sapiens. In doing so, the part of the body that intrigued them the most was her very over enlarged buttocks. A buttocks, that had never been seen on any other Black female body of that size. These scientists began to conclude that Bartmann's brain, buttocks, and breast were strictly related to the gorilla species, in which her enlarged buttocks supposedly relates. The inferiority complex was based on the mere idea and research that her genetic make-up was one disrupted through mutation. Mutation was considered during this time period as any phenotypical appearance different from that of the White European female. This "mutation" was set on display in a over sea's circus with other "freaks" such as the world's fattest man, the tallest woman, etc. These mutations were said to have a genetic make-up relating to animals only. The two scientists concluded that Bartmann was indeed not a woman based on the biological research found. She was considered to have some "human-like qualities" but no humane. These findings have created a ideological construction of racial difference embedded in biological practices. I am aware today that technology has surpassed such ludacris mentality, but have they really? I ask this question to not only take into the account of one's DNA, but to also have one explain the genetic makeup of a human whose genes coded for an allele for an over sized buttocks or enlarged breasts but isn't present among the parents.  DNA is genetic material inherited from both parents right? So, what happens when neither parent has an allele for a large buttocks, maybe this trait isn't even witnessed in any generations of this person's human genome. Then to what extent is this phenotypical expression explained...I bet those two European scientists would agree to mutation/polymorphism. What would you say?

Lassiter, Luke Eric. Invitation to Anthropology. United Kingdom: Alta Mira Press, 2009.   3-14.

8

Reading the chapter for this week about the history of human biology left me wondering what new information has come out since the publication of this chapter/book. Upon my search, I found an article in American Anthropologists discussing some of the major research that was published in 2012 that has helped to start shifting some long held theories. James Sun and colleagues did one of the main pieces of research discussed in this article. Sun’s research, along with others, has found that the “baseline rate of mutation, directly estimated from genomic sequencing, is slower than previously suspected (263, Van Arsdale).” This finding may influence the previous rate that evolution took place and more research has to be done before any large changes are made in the past research findings. The research I found the most interesting was that done by Herman Pontzer on the energy expenditure of hunter-gatherers. He studied thirty Hadza adults from Tanzani who are hunter-gathers, to compare to industrial populations. Ponzer found that the amount of energy expended by the Hadza was not significantly more than someone from the United States. This study helps to highlight the influence that energy consumption has on the cause obesity and how obesity is not all reliant on the lack of energy expenditure and lifestyle. The article also included a bit about open access journals and blogging one’s articles before it is published. I thought this part was an intriguing because it has some sort of reference to our class with the blogging we are doing. The publishers of journals do not like the blogging because it makes the articles irrelevant by the time they are finally published. I think this brings up a key question of what is more important making money off of these findings or sharing the information with people so that everyone can be better educated?

Overall, the article was insightful in showing how quickly research can come along that changes our ideas about a subject. The article featured the changing atmosphere of the academic world with the use of technology, which was really the first time I have seen how technology might change the way that influential journals, such as Human Biology, influence the research done as it has in the past.

2013. A shifting theoretical framework for biological anthropology in 2012. American Anthropologists, 115, 262-272.

Sierra Cannon- Additional Grad Article (Week 2 9-8-2014) #1

While reading the assigned material for class, I realized one of the major aspects of Human Biology was human adaption. In this instance, I then found an article in relation to human adaption. Human adaptation is referring to the way in which humans adapt to their specific environments. Inside the American Journal of Human Biology, I found an article entitled, “A Critique of the Grandmother Hypotheses: Old and New.” In this piece, Jocelyn Scott Peccei introduces menopause as  human adaptation among grandmothers vs. mothers. The conditions include the idea of grandmothers from different parts of the globe such as Hadza women from Tanzania, Kung tribe in Southern Africa, and Ye’kwana community in Venezuela in adapting during menopause to help aid the mother with future grandchildren. Menopause is viewed as quality over quantity in a way of producing future kin (grandchildren) through mothers (daughters). This hypotheses places menopause as an adapting event that aids the young mother in raising her children to soon produce a cycle of human longevity. This longevity is placed in an arena where grand mothering is viewed as post-reproductive aspects to healthy grandchildren. In other words, the space and time of menopause is used not only as a human adaption simply of women at a certain age (i.e. grandmothers), but also as a destined idea to solely reproduce grandchildren based on the inherited senescence of “grandmothers” during the period of menopause. This piece has many flaws, because it also relates men and women in the central realm of menopause, and how men may provide more for the children (grandchildren) than the seasoned grandmothers. The providing of knowledge and physical help to the mother is the essential contribution. Peccei allows menopause to be taken as not only an adaption of the human female body as in destiny, but more so as a meaning of simply contributing to the hereditary lineage of offspring. In all, this article was interesting but yet confusing. In my thoughts and by definition, menopause is a naturally occurring process in the female body during the age of about 40-50 in which menstruation stops. I do believe it to be a post-reproductive aspect in mothers/grandmothers, but i do hope it brings into account  the knowledge and wisdom of the aged grandmother to  pass down the qualities of life to the expecting mother not necessarily quantity over quality. The quantity vs. quality which relates to the survival of the kin, should not be based on menopause and its effects by each grandmother on her children or future grandchildren. In actuality, the quantity should always be viewed as quality in the aspect of time and space. Menopause should be viewed as a healthy adaptation among all mothers/grandmothers in regards to all future children.

1

My 23 and me genetic results were pretty blah. I was really hoping for something exciting or weird to pop up but that never happened. Although I still think my results are very interesting, I was just wanting some pizazz. I found out that I am 8.2% British and Irish which I pretty much already knew. I am 2.9% neanderthal which puts me in the 84th percentile, so I guess that is kinddddd of cool. My ancestry mainly comes from the UK, Ireland, Finland, India and Belgium. My most elevated health risk is rheumatoid arthritis, which I thought was great as opposed to something like cancer. The average person has a 4.2% risk of having rheumatoid arthritis and my risk is 9.0%. I am also at an elevated risk of melanoma, celiac disease and lupus. Under the inherited conditions section the only things I had variants present for hemochromatosis and glycosylation type 1A. I did not know what either of these things were so I did some google-ing and discovered that hemochromatosis is caused by the body absorbing too much iron from food and can lead to cancer, heart arryhythmias and cirrhosis. Thankfully this is more likely to be serious in men. Glycosylation type 1A is an inherited metabolic condition which mostly affects many systems of the body but mainly the nervous system. 23 and me also told me that if I were a smoker I would most likely smoke more.