Skip to content

Aging and senescence are two concepts of biological evolution that usually occur simultaneously. Aging is an inevitable process among all humans and animal species. The survival method and length may be different, but the body’s equipment will begin to deteriorate with time. Time is a process that cannot be reversed biologically or socially; therefore the body adapts overtime to such processes. In this, how the body is treated over time will result in rapid or reduced aging. The body will still age, but the rate of deterioration will be decreased. All of these mechanisms play into all bodily functions, the only separation is depending on the person, their diet, their physical activity and genetic makeup.

One in every 100,000 persons survive as long as 120 years old. Most men and women will not live to see this age. The average age for men before developing signs of senescence in 70 years old. At 70 years of age, Alzheimer’s and other degenerative conditions began to take its peak conditions. As mentioned earlier, the life conditions are based on the individual and his or her lifestyle. In an article entitled, “Late Life Human Development: Boosting of Buffering Universal Biological Aging” Kolling and Knopf introduces biological aging and senescence by describing telomere length (TL), theories of aging (evolutionary, stochastic, and deterministic), and free radical involvement.

In evolutionary aging theories, Weismann elaborates upon the idea of natural selection. This theory promotes Darwin’s ideas, but also the idea of group selection. Group selection states that aging benefits the group, even though it may be detrimental to the individual. He later proved this theory to be discrediting and presented the idea of disposable soma theory instead. This theory states that the organism separates germ and soma in order to maintain reproductive power due to evolutionary pressure. We all know this to be true, seeing as if the soma cells are all other cells other than the reproductive cells, and that reproduction only takes place during a certain lifespan, and it is not presented as an opportunity after a certain age in certain groups of men and women. Moving along, stochastic aging theory relies on the core idea that while individuals age, a significant amount of biological damage is accumulated over time in a random fashion as a by-product of normal living. My favorite of the three stochastic theories is the “wear and tear theory”. It proposes that the usage of the body and over time, cumulative damage occurs within the body leading to death of cells, tissues, organs, and finally the organism itself. Next, the “free radical theory” expounds upon how free radicals are produced during aerobic respiration later causing rapid death. These radicals place a threat to the aging organisms because of oxidative damage.

Finally deterministic aging theories presume that aging occurs because of genetically and endogenously programmed processes. One example is the absolute metabolic scope theory. This is a rather old theory which states, that the greater an organism’s oxygen basal, the shorter the lifespan. In all of these theories, they relate to telomere length of an individual’s chromosomes. In a study, longer telomeres at baseline were associated with reduce risk of death and dementia; however, research on the associations between telomere length as a predictive biomarker of mortality is still controversial.

Kolling, T., Monika Knopf (2014). "Later Life Human Development: Boosting or Buffering Universal Biological Aging."' GeroPsych Review. vol 27. (3), 103-108.

The body is a complex mechanism among both female and males. The growth of the human body depends on many factors including, the embryo stage, puberty, and physical activity among the growth years. In order for a body to progress/growth successfully, it must reach maturation biologically. This development promotes growth maturation for the remainder of one’s life in regards to future physical activity and performance. These activities dominate the daily lives of men and women. Based on the rate of growth in bones during embryonic development, the body will grow at the correct rate to produce a full body with full length bones. In the article entitled, “Top 10 Research Questions Related to Growth, Maturation, of Relevance to Physical Activity, Performance, and Fitness” Robert M. Malina explains the growth, body mass index, motor competence, peak height velocity, and tracking of infants, children, and adolescents. Adulthood will also be explained in correspondence to future maintenance of healthy bones and physical activity.

The cellular processes that underlie biological growth and maturation as well as other behavioral aspects cannot be measured directly; however, advances in technology are providing significant insights. Research and standardized tests have help to unpack growth in height, weight, and the stage of sexual maturity. Biologically, most girls are sexual mature by the age of 12 and boys by the age of 14. This maturity is solely biologically. Social maturity based on societal standards is reached by the age of 18 or 21. Height and weight are the body dimensions most commonly used to monitor growth. With age, children are expected to become taller and wider, unless otherwise deemed to be ineffective by disease. Such disease may alter the length of bones and their maturation. This in turn will also affect the physical activity and inactivity of adulthood. Trend in physical activity have been measured on boys and girls of the age 13 and 14. Researchers examined school sports, daily leisure, eating habits, and physical endurance. These performances explain the leading questions regarding growth, fat mass, BMI, and other measureable adipose tissue quantities.

Most recent surveys are based on moderate to vigorous activity (MVPA). The focus of the questions addressed is the amount and type of physical activity needed to bring about beneficial effects. Question 1: Is regular activity essential to support normal growth and maturation?  For the most part, studies show that youth who regularly engage in physical activity seem to have less adiposity (skinfolds, percent fat) than do those engage in less activity; however, enhanced activity programs as in interventions appear to have minimal effect on adiposity in normal weight youth. Question 2: Is BMI the most appropriate metric for overweight and obesity in youth? Question 3: What is the implication of the “adiposity rebound” for subsequent weight status and physical activity? Question 4: What is the role of physical activity in the prevention of “unhealthy weight gain” during childhood and adolescence? Researchers believe early childhood and the transition into middle childhood may be important windows of opportunity for intervention to limit excess weight gain. Maintenance of smaller gains in BMI and FM through regular physical activity over time thus has the potential to prevent unhealthy weight gain as well. Question 5: Is there a critical level of movement proficiency that facilitates physical activity and sport participation in children and adolescents? Motor skills and movement proficiency do go hand in hand, however the transition between each child may be different. The remainder of the five questions continues to address physical activity and growth, but obesity becomes the center of exploration.

Malina M. R. "Top 10 Research Questions Related to Growth and Maturation of Relevance to Physical Activity, Performance, and Fitness. (2014). Research Quarterly of Exercise and Sport. 85.157-173.

 

This weeks' reading revolved around stress on the human body. These blueprints to hormone level production, neuron response, and the neurological development was displayed in a case study by Aaron Kindsvatter and Anne Geroski. In this article entitled, “The Impact of Early Life Stress on the Neurodevelopment of the Stress Response System, they present a study with both an animal model and humans. This article is used to describe the functioning of the stress response system of the brain and to review literature pertaining to the impact of early life stress on the development of the stress response mechanisms.

The primary mechanisms of the stress response system include the sympathetic-adrenal-medullary axis (SAM), the limbic system and the hypothalamic-pituitary adrenal axis (HPA). The SAM axis involves direct connection between the norepinephrine center of the brain stem and the adrenal glands and is associated with the activation of the sympathetic branch of the autonomic nervous system. Most would also refer to the system in regards to the para-sympathetic nervous system in reference to a “flight or fight” response. Under this division of the autonomic nervous system, this response also helps to regulate homeostasis and allostasis. The HPA plays a key function in stress response by initiating a series of neurotransmitters and Nero hormonal cascades that, among other functions, serve to regulate the body’s response to stress.

These researchers used both rats and cats as control groups to help correlate stress among early development to adult hood. Among the cats, they inhibited some of the cats from using their right eye upon birth. In this they found that these now grown cats developed conditioned eye sight even after eye sight with both eyes were permitted. This carried on neuro-response was also relate able to maternal instincts among mothers of human under post and prenatal stress. Among this study, the same results among the cats and rats were valid. These lasting effects per-conditioned the brain to produce more stress relieving hormones. More ACTH and CRF resulted in the diagnosis of PSTD. This study was also compared to cortisol levels of adult survivors of child abuse. Within all of the new found diagnosis, the idea of threat experienced at an early age resulted in lifetime effects of such bodily productions to counteract future threats.

In all, the body’s response to previous witnessed ideas of threat will promote certain synaptic response with different levels of hormone production; hence, why some people experience strokes more rapidly. Stress can cause major body dysfunctions. It is even one of the leading cause of death in the U.S. Stress will condition the brain to adapt to certain experiences at certain times, without this modification through early stress level identification, the explanation of stressful adulthood might be still in question.

Geriski and Aaron Kindsvatter (2011). "The Impact of Early Life Stress on the Nuerodevelopment of the Stress Response System". American Counseling Association.

1

Human epidemiology is the study of disease, its contributions and disparities, and potential ways to help stop the spread of disease. Among the West, there are many different diseases, viruses, prions, and other contagions that are incurable. Even among all the technology, in-depth research, and major complex studying among control variables, the West is still highly undeveloped; or, at least this is what one is lead to believe. However, there are many treatments, remission possibilities, and rehabilitation methods available. Among the many incurable diseases, Crohn’s disease has begun to resurface. This reappearance however, has been among children and teenagers not adults as witnessed in the past.

In the article entitled, “Pediatric Crohn’s Disease: Epidemiology, and Emerging Treatment Options”, Kansal and Smith explore Crohn’s disease and its affects globally on children ranging from 0-14 years of age. Crohn’s disease was first described as a clinical entity by Burrill B Crohn and colleagues in the USA in 1932 and has traditionally been regarded as a disease of the Western world. It is currently believed that Crohn’s disease occurs as part of interplay between environmental and immunological factors in a genetically susceptible host.  A rising incidence in both adults and children has been observed in recent years, with some studies suggesting a ten-fold to 20-fold increase in children over three decades. Crohn’s disease currently affects about 700,000 people in the USA and about a million in Europe. It’s a disease that affects the gastrointestinal tract (gut), which eventually causes bone degradation and/or abnormal growth among young children. Researchers have even reported it to relate to IBD (inflammatory bowel disease). It would make sense seeing as if the gut includes the small intestine which assists in digesting nutrients to be distributed throughout the body. Moreover, if the first initial site of absorption is interrupted, proper bowel movement, as well as building healthy bones in development suffer traumatically.

While the peak age of new diagnosis for Crohn’s disease overall is between the second and fourth decades, the average age in pediatric practice is about 11 years. A study from Scotland reported a doubling of the incidence of pediatric Crohn’s disease over the 15-year period to 1995, with an overall averaged standardized incidence rate of 2.5 cases per 100,000 populations for the period. Marked increases in pediatric diagnoses have also been confirmed in other parts of Europe, such as Sweden, Czechoslovakia, and the UK, while elsewhere, such as Canada and the USA, they appear to have plateaued after previously documented increases.

One of the most interesting conclusions is that genetic susceptibility for Crohn’s disease is defined as how the host interacts with its microbiota. The search for a microbial trigger for Crohn’s disease has been carried out in two ways, either a specific transmissible agent or a dysbiosis involving the gastrointestinal microbial milieu. With this, researchers have found many treatment options. Most treatment options have been reared toward inflammation. Traditionally, the Step-Up treatment option was used for adults, but history of the disease along with uprising epidemic, a  new method known as Top-down therapy is being administered to help with prevention of structural damage by achieving mucosal healing with this past use of immunosuppressants and biologicals. As mentioned, there is no cure for Crohn’s disease, but therapeutic interventions are designed to relieve symptoms, improve the quality of life, and avert-long-term complications.

Shavani Kansal, Anthony J. Smith (2014). Pediatric Crohn’s disease: epidemiology and emerging treatment options. Pediatric Health, Medicine and Therapeutic. University of Melborne.

The human body is very complex, yet simple mechanism. The way in which cholesterol (fats), minerals, and vitamins contribute to the nutrients within the body range. The human body is made of millions of cells that are directed by DNA to make certain proteins, which then code for the insertion of amino acids (polypeptide chains). These amino acids then contribute to enzyme regulation and the production of hormones throughout the body. All of these components contribute to cell nutrients, the amino acids that our bodies are not capable of making must be consumed through foods. When the body does not consume the right amount of amino acid or vitamin supplement, it begins to become insufficient and incapable of ridding the body of toxic materials, as well producing a healthy immune system. In all, the way you eat, the amount of water consumed, and your ability to help the body rid unhealthy fats (toxins) by exercising and detoxification are the mechanisms for having a productive body.

Most Americans in the United States are considered to be obese. The body is made up of fat cells from the accumulation of cholesterol. Keep in mind, all fat isn’t bad fat. Yes, there are healthy fatty acids inside the body that contribute to the body’s overall energy consumption; hence; why one is able to exercise or simply keep the body in motion. Fatty acid cells are found in the muscles of cells and produced by lipoproteins. They are also referred to as adipose tissue. The accumulation of too many fatty acids cells contribute to obesity. Obesity is a condition that is considered to accompany an unhealthy lifestyle. It also slows the body’s circulation because not enough oxygen can pass through selectively permeable membranes. This in turn leads to blood clotting and obviously an accumulation of fatty tissue all over the body. Most people who are obese are consumers that cannot control their calorie intake. Calorie intake is the issue at hand in order to help produce a healthy lifestyle.

In the article I found entitled, “Calcium and Vitamin D for Obesity” researchers used a review of randomized control trials (RCT’S) to show if more calcium and vitamin D intake help contribute to weight loss. They used the trial with women only. Among these women, there hypothesis consisted of the idea that calcium intake during weight loss should result in greater fat loss. The fat percentage measured on the body is the total accumulation of fat in the body. The higher the percentage the higher the risk of heart disease. Also, weight loss was only considered in this trial in relation to BMI and fat percentage. Researchers were not simply intrigued by the number on the scale. They found that calcium and vitamin D support does not support calorie intake, but can suppress appetite. Researchers also reported higher calcium was much better than moderate calcium accelerating weight loss over time; though, differences in fat mass were not significant. On the other hand, vitamin D supplementation presented no effect on changes in body weight, waist-hip ratio, or percent fat mass. Overall, the idea that calcium and vitamin D contribute to weight loss was highly insignificant. I do believe the study may have been done broader and more biological aspects should have been taken into consideration. The study was only used with women, but the calcium or vitamin D present prior was not taken into consideration. These trials could have very well been witnessed on calcium deficient individuals, which then places the trial under high scrutiny. In other words, maybe this randomized trial should have been a conditioned group of women to measure such bodily contributions. Do you agree?

Delfos, Chan, Ghanbari M. Calcium and Vitamin D for Obesity: A Review of Randomized Trials. European Journal of Clinical Nutrition. Sept. 2011, Vol. 65. Issue 9 p. 994-1004.

(Ch.7 Blog entry- Human Nutrition)

In this week’s reading, climate change and adaption among humans was the issue at hand. We learned that human-occupied environments of today are extremely different from those of tropical forests beginnings as well, historical Neanderthals. Within environments, one’s body will either adapt to hot or cold conditions. The way in which the body adapts to these environments is known as thermoregulation in correspondence with homeostasis. They body reacts based solely on its environment. With this aspect, we can also expand this knowledge into broader realms of nutrition. In direct relation with body temperature, the contraction of muscles, and acclimatization, what is put into the body helps regulate certain temperatures. Ecologically speaking, agricultural production is also based on particular environmental conditions. Without the production of fruits, vegetables, and domesticated farm animals, the average human body cannot exist very long in strenuous environments of excess heat or extreme cold. This brings to my article entitled, “Public Health and Climate Change Adaptation at the Federal Level.”

In this piece, Jeremy J. Hess and Paul J. Schramm, identify on a federal level, agencies response to an executive order by President Obama among public health and climate change adaptation. They began by exploring what climate change is, and how it contributes to executive orders of public health. “Climate change is projected to cause many adverse health effects in the United States and abroad. The adverse health effects will result from a range of direct and indirect exposures that come from shifting ecosystems dynamics; worsening air quality, increasingly frequent and severe extreme heat events; shifts in precipitation, including more frequent and severe storms and floods; sea level rise; and ocean acidification.” The Department of Health and Human resources, which houses the CDC and other agencies, take part in a wide range of activities affected by climate change. It ranges from ensuring food safety to research formulating healthcare policy. Climate change and adaptation has become such a grave issue among the CDC that federal law has to be more incorporated for health disparities as well as a larger outlook on global warming. They begin with an assessment of recent and projected future climatic shift, considers how these shifts affect agency missions and operations, and then moves toward development of adaptation plan and a formalized institutional learning component.  CDC programs range from disaster preparedness to vector-borne and zoonotic disease programs to other programs addressing global health.

Each program seeks to identify populations most vulnerable to certain impacts, anticipate future trends, and assure systems are in place to detect and respond to emerging health threats, and take steps to assure that these health risks can be managed now and in the future. In my opinion, it seems like the government is actually taking human adaption to climate change into account globally. The interesting idea about this program projection and federal law efforts is the issue around disease. I’m fully aware that climate changes and other environmental factors contribute to disease, but with ongoing epidemic of Ebola, do you guys believe this executive order is reared more toward climate adaption, or public health, or both? This article was slightly misleading in my opinion, because of the executive order, the mention of disease, but not much information on direct contact with the human bodies throughout the U.S. and abroad. In other words, all these programs may sound intriguing, but when will they be implemented and to what extent?

J. Hess and J. Schramm. Public Health and Climate Change Adaptation at the Federal Level. American Journal of Public Health. march 2014, Vol 104, No. 3.

The world as a global structure is composed of an “admixture” of genes. This “admixture” is a population whose genes consist of different inherited blood lines (i.e. European, African, Asian, and Latino).  Among these different descendants, race becomes an issue. Race is viewed throughout the Fullwiley, and Weiss and Long article as a way in distinguishing health disparities, a way of explaining Darwinism, and a crucial statistical relation to biology. Within this particular framework, population genetics and ancestral lineage plays a role in human settlement and development of the human body. This brings me to my article entitles, “The Case against Biological Realism about Race: From Darwin to the Post-Genomic Era.” In this piece, Maglo argues that race functions in contemporary human population genetics, more like a convenient instrumental concept than biological category for picking out sub specific evolutionary kinds.

Evolution is a term coined by Charles Darwin. It is described as the development of different types of organisms by natural selection. In Darwin’s description race was presented in his theory of application; however Maglo describes how race through the idea of “progression” among a species has created a framework of racial hierarchy that is inevitable in the biogenetics world. He explains how science as accumulated findings among minority groups, specifically African Americans has been the blue print to disease. A group of researchers argues that race has an objective biological reality, and is a valid prediction tool of genetic and phenotypic variation within our species, while another group counters that race is biologically meaningless and a weak predictive factor of human genetic and phenotypic variation. Which group of researchers would you agree with? I would personally argue the second group. Race is a social construct. IT was created as a subsection by Herbert Spencer with Social Darwinism in the 19th century. Social Darwinism states that Darwin’s idea is valid, but only through social progress. Well, we don’t need to embark upon the history of what “group” could socially progress, I’m sure the answer is pretty straight forward. With that being said, progression among the human species is a science created through race.

The biological make-up of the human body regardless of skin color, works as a system designed for survival. The genes that a human body is composed of may be different, but their functions unless otherwise defective, all contribute to homeostasis. Without, the critiques of previous evolutionists/scientists (Spencer, etc.) biology would simply only contain a genus/species relation, not a subspecies among human organisms. Even the idea of polygenesis is a key principle of evolution among present day scientists/biologists. Why? Humans are humans, Apes are Apes, and microorganisms are microorganisms. Polygenesis relates to the idea that some humans (i.e. minority groups-African Americans) are a subgroup of individuals that share common characteristics. Who came up with this? The issue is one of high concern among researchers today. These concepts began to group certain people in an array of abnormalities that doesn’t necessarily apply on a biological level. Now, race is clearly a visual aspect that has been created to systematically categorize development, substanciabilty, and tactical relations of disease. Is it right, no; however, is there a solution to the erasing RACE completely in regards to biology? Is this possible?

Maglo, Koffi N. Perspectives on Science 2011, vol.19, no.4. 2011. "The Case against Biological Realism about Race: From Darwin to the Post-Genomic Era

5

Epigenetics is the study of the processes that underlie developmental plasticity and canalization and that bring about persistent developmental effects in both prokaryotes and eukaryotes. In my research, I came across a rather difficult yet slight interesting article entitled, “How might epigenetics contribute to ecological speciation?” Ecological speciation involves the formation of a new species in the course of evolution with one’s physical surrounding. It interplays with adaption to different environments and the concurrent incompatibility of reproductive isolation. Epigenetics is viewed as a process that does not interrupt the DNA in organisms. It can be an induced processed based from generation to generation through germ line cells or somatic cells. However, in embryonic development epigenetics changes its course. In the formation of a zygote, DNA methylation can occur as a biochemical process. Most epigenetics witnessed in this article pertain to DNA methylation and phenotypic plasticity. Of course, phenotypic plasticity is in more correlation to fish or the Drosophila in this research more so than humans. In this piece, Smith and Ritchie describe phenotypic plasticity as often allowing organisms to respond adaptively to environmental factors. Adaptation to a range of new environments may follow a single invasion event, for example when fish invade glacial or other new lakes, or occur with on-going gene flow or fluctuating environments.

One interesting and understandable method mentioned in this article was the criticisms of epigenetic marks in evolution. There we three main factors that contribute to the controversy. First, epigenetic variation is not seen as a primary driver of evolution in the same way as mutations. I personally cannot disagree or agree with this critique, because a mutation is usually witnessed with a disruption of DNA in humans, not necessarily the external environment; however, I cannot speak for all other organisms. Secondly, an important aspect of Neo-Darwinism is that evolution is not “directed”, since it can be induced and stably inherited, it can then be seen as directed. Thirdly, epigenetic marks are seen as dependent on DNA and thus do not evolve independently of genetic variations. Now, this I can partially agree. I realize in this article as well as the required reading by Jalon and Razz that RNA was mentioned throughout in regards to prions, rRNA, and DNA methylation. I couldn’t see how RNA could be discussed without the use of DNA since they are partners in regards to translation and transcription. Later however, I did realize epigenetics transformation from generation to generation with induction and allopolyploidization. In all, one’s environment can result in adaptability among organisms without altering their DNA obviously. Now, do I agree completely is a different question.

1

Cite: Turkish Journal of Medical Sciences (12/1/2013) http://eds.a.ebscohost.com/eds/pdfviewer/pdfviewer?sid=99d3b622-6d0f-49f9-89ab-c502cd16a588%40sessionmgr4003&vid=2&hid=4203

This week’s reading is based upon allele frequency among certain populations. While reading this chapter, I came across a very interesting article evaluating allele frequency in Europe in relation to Africa, Asia, and South America. In this article is speaks on the mutant CCR5 delta 32 allele. This allele has been researched, and data shows resistance to HIV and later developed AIDS. As we all know, there is not a cure for AIDS; however; I personally didn’t know there was even a resistance to the disease besides condoms and abstinence. I mean please correct me if I’m wrong. This is exactly why this article intrigued me greatly. In this experiment, 400 healthy individuals were chosen and blood samples of 2cm^3 were taken to see if the allele was present in each individual. With this experiment, the participants were mostly not of African descent. It has been statsically proven that people of African American descent are more infected with the deadly disease, and therefore positioned as an “African American” disease. Now, I do not agree with this categorically since the spread of the virus/disease has been historical recorded to have originated from a South African (White) male. So, how exactly is it considered to be a “Black” disease? Either way, this ideological approach is also the reason why I believe more research should be done in this area concerning individuals of African descent solely. I’m sure the authors of this article would highly disagree seeing as if the allele frequency was so low that Africa or groups of African blood were not really considered. On a different note, the allele is said to be detected from chemokine receptors located on the third chromosome. This then interacts with the chemokine 2 receptor with the 32 base pair amino acid deletion sequence of one’s gene. This mutant gene is then related to HIV resistance. The results are as follow:

Results

CCR5-Δ32 allele frequency as related to resistance against

HIV was determined with the analysis of blood samples

Obtained from a total of 400 individuals. Blood samples

Were collected in such a way as to represent all provinces

included in the region. Twenty-one of the individuals

who were screened with 2 primers were found to be

heterozygous in terms of the CCR5-Δ32 allele (CCR5/

CCR5-Δ32). No homozygous individuals (CCR5-Δ32/

CCR5-Δ32) were determined in the study. A single band

measuring 241 bp was detected in individuals with the

CCR5/CCR5 genotype and 2 bands measuring 209 and

241 bp were determined in individuals with the CCR5/

CCR5-Δ32 genotype as a result of screening samples with

the SP4.760 primer (Figure 1). A single band measuring

225 bp was detected in individuals with the CCR5/CCR5

genotype and 2 bands measuring 193 and 225 bp were

determined in individuals with the CCR5/CCR5-A32

genotype as a result of screening with the AB primer

(Figure 2).

While the wild allele frequency was found to be 0.9738

for all individuals, the mutant allele frequency was 0.0262.

In the statistical analysis done according to geographical

regions, while wild allele frequency was found to be 0.9590

for the population representing the Black Sea region,

Table 1. Distribution of participants according to number and

regions.

Regions Number of participants

Black Sea region 61

Marmara region 58

Aegean region 57

Mediterranean region 54

Southeast Anatolia region 54

East Anatolia region 54

Central Anatolia region 62

TOTAL 400

Table 2. Names and sequences of primers used in the study.

Names of primers Sequences of primers (5’-3’)

SP4.760 CCTCATTACACCTGCAGCTCT

CACAGCCCTGTGCTTCTTCTT

AB ACCAGATCTCAAAAAGAAGGTCT

CATGATGGTGAAGATAAG CCTCACA888

KARAKAYA et al. / Turk J Med Sci

mutant allele frequency was 0.0410. No heterozygous

individuals who had the mutant genotype were detected

in the population representing the Marmara region.

While wild allele frequency was found to be 0.9825 for

the population representing the Aegean region, mutant

allele frequency was 0.0175. While wild allele frequency

was found to be 0.9274 for the population representing

the Central Anatolia region, mutant allele frequency was

0.0726. While wild allele frequency was found to be 0.9722

for the East Anatolia region, mutant allele frequency

was 0.0278. While wild allele frequency was found to be

0.9907 for the population representing the Mediterranean

region, mutant allele frequency was 0.0093. While wild

allele frequency was found to be 0.9907 for the Southeast

Anatolia region, mutant allele frequency was 0.0093. The

Central Anatolia region was found to have the population

with the highest heterozygous percentage among the

analyzed populations. Heterozygous statistical values

for all individuals are given in Table 3. In addition, the

chi-square value used in Hardy–Weinberg equilibrium

analysis was estimated to be 0.276506, the freedom degree

to be 1, and probability (P) to be 0.599000 (Table 4).

During this week's reading, I came across an article by Eric Lassiter entitled, "Invitation to Anthropology. It is an article that uses genes, chromosomes, and evolutionary biology in a different manner, but simutaneously the same. In this anthropological piece, Lassiter retraces the idea of biology among the Black female body. He chooses to investigate non-other than Sarah Bartmann, also known as "The Venus Hottentot."This African non-slave woman was taken under great scrutiny by two European scientists in the later 19th century. These scientists dissected every inch of Bartmann's body starting with her cranium on to the bottom of her feet. The brain of a Black woman was sized categorically as one of difference in regards to Europeans. They viewed her as an animal species, not one of homo sapiens. In doing so, the part of the body that intrigued them the most was her very over enlarged buttocks. A buttocks, that had never been seen on any other Black female body of that size. These scientists began to conclude that Bartmann's brain, buttocks, and breast were strictly related to the gorilla species, in which her enlarged buttocks supposedly relates. The inferiority complex was based on the mere idea and research that her genetic make-up was one disrupted through mutation. Mutation was considered during this time period as any phenotypical appearance different from that of the White European female. This "mutation" was set on display in a over sea's circus with other "freaks" such as the world's fattest man, the tallest woman, etc. These mutations were said to have a genetic make-up relating to animals only. The two scientists concluded that Bartmann was indeed not a woman based on the biological research found. She was considered to have some "human-like qualities" but no humane. These findings have created a ideological construction of racial difference embedded in biological practices. I am aware today that technology has surpassed such ludacris mentality, but have they really? I ask this question to not only take into the account of one's DNA, but to also have one explain the genetic makeup of a human whose genes coded for an allele for an over sized buttocks or enlarged breasts but isn't present among the parents.  DNA is genetic material inherited from both parents right? So, what happens when neither parent has an allele for a large buttocks, maybe this trait isn't even witnessed in any generations of this person's human genome. Then to what extent is this phenotypical expression explained...I bet those two European scientists would agree to mutation/polymorphism. What would you say?

Lassiter, Luke Eric. Invitation to Anthropology. United Kingdom: Alta Mira Press, 2009.   3-14.